Código Genético Exercícios para passar no Enem

01. Código Genético Exercícios: (FEI-SP) Cientistas admitem que vários aminoácidos podem ser codificados por mais de uma trinca de nucleotídeos no mecanismo da síntese de proteínas intracelular. Tais cientistas dizem, por isso, que o código genético:

A) é degenerado.
B) é o DNA e o RNA.
C) não pode ser entendido.
D) não se relaciona aos genes.
E) é exclusivo dos animais superiores.


02. (UEL-PR–2009) Considere as afirmativas a seguir sobre as propriedades do código genético.

I. Existem vinte e quatro tipos de aminoácidos, que, agrupados em diversas sequências, formam todos os tipos de proteínas que entram na composição de qualquer ser vivo.
II. Ocódigogenéticoéuniversal,poisváriosaminoácidos têm mais de um códon que os codifica.
III.A perda ou a substituição de uma única base nitrogenada na molécula de DNA pode alterar um aminoácido na proteína.
IV. Nos organismos, a relação entre o número de nucleotídeos (a) de um mRNA e o número de aminoácidos da proteína formada (b) mostrou que a/b = 3.

Assinale a alternativa CORRETA
A) Somente as afirmativas I e IV são corretas.
B) Somente as afirmativas II e III são corretas.
C) Somente as afirmativas III e IV são corretas.
D) Somente as afirmativas I, II e III são corretas.
E) Somente as afirmativas I, II e IV são corretas.


03. (Unimontes-MG–2007) Processamento do RNA ou splicing é a remoção de sequências não codificadoras de proteínas (íntrons), produzindo um RNA que é traduzido em uma proteína funcional. A teoria do splicing alternativo mostra que um mesmo mRNA pode ser clivado em diferentes locais, unindo os fragmentos em diferentes ordens e tamanhos.

Considerando a informação apresentada e o assunto relacionado com ela, analise as afirmativas a seguir e assinale a alternativa INCORRETA.
A) O tamanho do genoma é diretamente proporcional à quantidade de proteínas traduzidas.
B) Um gene pode corresponder a mais de um tipo de proteína.
C) O splicing alternativo é um dos mecanismos geradores de diversidade proteica.
D) A teoria do splicing alternativo altera o dogma “um gene – uma proteína”.


04. (UFMG) Observe a sequência de bases nitrogenadas.

123456789
TACTCAGACCATGCTTAATCGCTCACC

Todas as afirmativas são corretas quanto à sequência, EXCETO:

A) A introdução de uma adenina (A) entre as trincas indicadas por 2 e 3 pode alterar toda a transcrição a partir desse ponto.
B) A mutação da terceira base da trinca indicada por 9 pode traduzir um aminoácido diferente.
C) A sequência pertence a um DNA e pode codificar um polipeptídeo contendo, pelo menos, 27 aminoácidos.
D) A trinca indicada por 5 pode transcrever um códon CGA, o qual é reconhecido pelo anticódon GCU.
E) A troca da primeira base, em quaisquer das trincas indicadas, pode resultar na troca do aminoácido respectivo na proteína.


05. Código Genético Exercícios: (UFU-MG–2009) A mutação gênica é uma alteração que ocorre na molécula de DNA ao atingir a sequência de bases. Essa mutação é determinada por falhas na replicação do DNA, que, quando alterado, codifica uma mensagem que leva à produção de proteínas modificadas, alterando o fenótipo. Mutações podem ser favoráveis ou desfavoráveis ao organismo, dependendo do ambiente.

Durante a replicação, a fita – A – C – G – T – T – A – C – C – G – sofreu uma mutação a qual gerou a produção da fita complementar – T – G – C – G – A – T – G – G – C –.

Essa mutação ocorreu devido à:
A) substituição de nucleotídeo.
B) adição de nucleotídeo.
C) inserção de nucleotídeo.
D) depleção de nucleotídeo.


06. (UFU-MG) O aminoácido leucina pode ser codificado por mais de uma trinca de nucleotídeos do DNA (AAT, GAA e outras). Assim, podemos dizer que

I. o código genético é degenerado, o que significa que um aminoácido pode ser codificado por mais de uma trinca.
II. um aminoácido pode ser codificado por apenas uma trinca de nucleotídeos de DNA.
III.assim como a leucina pode ser codificada por diferentes trincas, uma determinada trinca também pode codificar diferentes aminoácidos.

Está(ão) CORRETA(S) A) apenas III.
B) apenas II.
C) apenas I.
D) I e III.
E) nenhuma delas.


07. (UFMG) O trecho CGACUG de uma molécula de RNA mensageiro é sintetizado a partir do seguinte trecho de DNA:

A) CGACUG
B) CGGTCA
C) CUGCGA
D) GUCAGG
E) GCTGAC


08. (FCMSC-SP) Considere a seguinte sequência de reações:
gene fenilalanina exercício
Um indivíduo tem anomalias na pigmentação do corpo, e seu metabolismo é prejudicado pela falta de hormônio da tireoide; o funcionamento das glândulas suprarrenais, porém, é normal. De acordo com o esquema, os sintomas que apresenta se devem a alterações

A) no gene I, exclusivamente.
B) nos genes I e II.
C) nos genes I e III.
D) nos genes II e III.
E) nos genes III e IV.


09. (FMTM-MG) Observe a via metabólica.
via metabolica de alguns genes

Devido a algum problema cuja causa é desconhecida, uma criança, ao nascer, demonstrou ausência total do produto C. Os médicos propuseram, alternadamente, três tratamentos, cujos resultados foram:
• Administração do produto A – ineficiente.
• Administração do produto B – eficiente.
• Administração do produto C – eficiente.

Tais resultados sugerem que o problema pode ter sido causado
A) por uma mutação no gene C.
B) por uma mutação no gene A.
C) pela ausência da enzima C.
D) pela ausência da enzima A.
E) por uma mutação no gene B.


10. Código Genético Exercícios: (Enem–2009) A figura seguinte representa um modelo de transmissão da informação genética nos sistemas biológicos. No fim do processo, que inclui a replicação, a transcrição e a tradução, há três formas proteicas diferentes denominadas a, b e c.
replicação e transcrição do rna exercícios

Depreende-se do modelo que:
A) a única molécula que participa da produção de proteínas é o DNA.
B) o fluxo de informação genética, nos sistemas biológicos, é unidirecional.
C) as fontes de informação ativas durante o processo de transcrição são as proteínas.
D) é possível obter diferentes variantes proteicas a partir de um mesmo produto de transcrição.
E) a molécula de DNA possui forma circular e as demais moléculas possuem forma de fita simples linearizadas.


🔵 >>> Confira a lista completa com todos os exercícios sobre Genética.


Gabarito do simulado de genética sobre o Código Genético Exercícios com gabarito para passar no enem e vestibular:

01. A;
02. C;
03. A;
04. C;
05. A;
06. C;
07. E;
08. E;
09. E;
10. D

Gostou desta lista de Exercícios? Não esqueça de compartilhar com seus amigos:

Deixe um comentário